(Solved): 7. (4 Pts) The Following Is A Piece Of DNA. Assume That TATAAAT Is The Promoter Region (TATA Box) An ...
7. (4 pts) The following is a piece of DNA. Assume that TATAAAT is the promoter region (TATA box) and that transcription at base 10 downstream. 5' CTCCAAGAGCTATAAATGGATAGATGATGGGTAGGGCAATACATCCATTTATACTCTACGCCCT 3 3' GAGGTTCTCGATATTTACCTATCTACTACCCATCCCGTTATGTAGGTAAATATGAGATGCGGGA 5 a. Mark the TATA box b. What is the direction of transcription? ? or C. Assign which is the template strand and coding strand for this gene d. Write out the first 10 mRNA bases made. e. Is there another TATA box elsewhere? if so mark it. f. What is the direction of transcription for this promoter? ? or g. Assign which is the template strand and coding strand for this gene h. Write out the first 10 mRNA bases made.
Expert Answer
a.5' TATAAAT 3' 3' ATATTTA 5' b.Direction of transcription is 5' - 3' c. 5' to 3' is a coding strand and 3' t