(Solved): Exon1 Intron GTA Exon 2 Intron 4. (1 Points) You Have Printed Out A Set Of DNA Sequences Around The ...
exon1 intron GTA exon 2 Intron 4. (1 points) You have printed out a set of DNA sequences around the intron-exon boundaries of a gene in the B-globin family. You take your file with you to a place where there is no internet (is there such a place?). When you look at the printout, you discover that you forgot to write down which is the intron and which the exon. They are either exon 1-intron (top box) or intron-exon2 (bottom box). Look as the conservation of the sequences in different species. exon 1 GTR GGTGGTGAGGCCCTOGGCAGIGTAGTATOCCACYTACANG - Cow GOTOGTGAGATTCTGGGCAGGTAGTACTGGANGCCGGGG - gorilla aaaaa?a??a?????????? ?????????????coccc?? - chicken GGTGTGAGGCCCTGCGCAG GTTOGTATCAACOTTACANG - human GOTOGTGAGGCCCTGGCCAG ICTTGGTATCCAGOTTACAAG - mouse GGTGGTGAGGCCCTGGGCAG GTTGGTATCCTTTTTACAGC - rabbit GGCCATGATGCCCTGACCAG GTAACTTGAAGCACATTGCT - frog AGOexon 2 intron B Figure out which is the correct labeling: exon 1-intron or intron-exon 2. (Hint: which is more likely to be conserved? The intron or the exon?)